ID: 996715805_996715812

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 996715805 996715812
Species Human (GRCh38) Human (GRCh38)
Location 5:126587152-126587174 5:126587183-126587205
Sequence CCAGAGATGGGAGGGAAAATGAG GGGATGCAGACGGCAGAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 358} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!