ID: 996862759_996862773

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 996862759 996862773
Species Human (GRCh38) Human (GRCh38)
Location 5:128084073-128084095 5:128084119-128084141
Sequence CCTCGGTGCCGGAGGATGCTGCG GGTCCGCGATGAGGGCCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 178} {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!