ID: 996884276_996884281

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 996884276 996884281
Species Human (GRCh38) Human (GRCh38)
Location 5:128337725-128337747 5:128337749-128337771
Sequence CCACAAGGACTTCCACAGGGCTC TCACACAGGGACCAATCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 211} {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!