ID: 996884276_996884283

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 996884276 996884283
Species Human (GRCh38) Human (GRCh38)
Location 5:128337725-128337747 5:128337768-128337790
Sequence CCACAAGGACTTCCACAGGGCTC GTGGCTTGTTATAAAAAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 211} {0: 1, 1: 0, 2: 1, 3: 24, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!