ID: 996993301_996993303

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 996993301 996993303
Species Human (GRCh38) Human (GRCh38)
Location 5:129663569-129663591 5:129663602-129663624
Sequence CCCACTTTCTTTTGGTTACTAAG TTTTTCTACAGAGTATCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 471} {0: 1, 1: 0, 2: 2, 3: 32, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!