ID: 997258200_997258203

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 997258200 997258203
Species Human (GRCh38) Human (GRCh38)
Location 5:132445369-132445391 5:132445386-132445408
Sequence CCAGAGGTATGTCTAGGGTGTGG GTGTGGTAGTAGCAGTGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!