ID: 997597536_997597544

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 997597536 997597544
Species Human (GRCh38) Human (GRCh38)
Location 5:135117091-135117113 5:135117115-135117137
Sequence CCAGGCACCAGCTGTGTGCCCAG GCTGTGTGATGTGCTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 532} {0: 1, 1: 0, 2: 3, 3: 43, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!