ID: 997601508_997601514

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 997601508 997601514
Species Human (GRCh38) Human (GRCh38)
Location 5:135141728-135141750 5:135141750-135141772
Sequence CCCTCAATTTCTCCCAAATGTGC CGTGAATTGTTGAGGGCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!