ID: 997640392_997640401

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 997640392 997640401
Species Human (GRCh38) Human (GRCh38)
Location 5:135445110-135445132 5:135445138-135445160
Sequence CCCTCCAGGGTCTCCTTGGCAGG TCCCCTATGAGCCTCTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 236} {0: 1, 1: 0, 2: 1, 3: 13, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!