ID: 997658283_997658288

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 997658283 997658288
Species Human (GRCh38) Human (GRCh38)
Location 5:135571321-135571343 5:135571344-135571366
Sequence CCCGGCTACAGGGGCCACTGTGG AGTCACACTGAGGCTGTGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 309} {0: 1, 1: 0, 2: 4, 3: 18, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!