ID: 997681081_997681083

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 997681081 997681083
Species Human (GRCh38) Human (GRCh38)
Location 5:135751116-135751138 5:135751151-135751173
Sequence CCGTGCACTGGCTGGTGAACTAG TGTTTGACACTGCTGAATTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 51, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!