ID: 997727462_997727472

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 997727462 997727472
Species Human (GRCh38) Human (GRCh38)
Location 5:136133264-136133286 5:136133284-136133306
Sequence CCCTGGAGGGGACCCCCTGACCC CCCCGCGCTGTCCTGGGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 202} {0: 1, 1: 0, 2: 1, 3: 33, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!