ID: 997739742_997739751

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 997739742 997739751
Species Human (GRCh38) Human (GRCh38)
Location 5:136243134-136243156 5:136243176-136243198
Sequence CCTTCCTCTTCCCCTTGGGACAG TGGTTTTTGTGAGCTGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 353} {0: 1, 1: 0, 2: 2, 3: 38, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!