ID: 997803540_997803546

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 997803540 997803546
Species Human (GRCh38) Human (GRCh38)
Location 5:136890629-136890651 5:136890662-136890684
Sequence CCAAACAAATGTTAGCCACTTTT GCCAGGCACCATGCTAGGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!