ID: 997864096_997864104

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 997864096 997864104
Species Human (GRCh38) Human (GRCh38)
Location 5:137445404-137445426 5:137445449-137445471
Sequence CCAGATTGAGAAGAGAAAAAAAA CTGGGCACTCAGAGGCAACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 39, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!