ID: 998051012_998051019

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 998051012 998051019
Species Human (GRCh38) Human (GRCh38)
Location 5:139035486-139035508 5:139035522-139035544
Sequence CCAGTCACCGGCTGCCTTGGCAA CTTTTTCGGAGACAGACCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 18, 4: 109} {0: 1, 1: 14, 2: 6, 3: 11, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!