ID: 998066067_998066075

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 998066067 998066075
Species Human (GRCh38) Human (GRCh38)
Location 5:139159968-139159990 5:139160013-139160035
Sequence CCTCATTAGGCATCACAGAAGTG GTCAAGAGCATCTCAAGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 216} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!