ID: 998099362_998099370

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 998099362 998099370
Species Human (GRCh38) Human (GRCh38)
Location 5:139419316-139419338 5:139419368-139419390
Sequence CCTAGTAACACTTGCTGGAGCTG CTGTCTCCAGAGAGGGAAATAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 128} {0: 1, 1: 0, 2: 0, 3: 39, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!