ID: 998100215_998100225

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 998100215 998100225
Species Human (GRCh38) Human (GRCh38)
Location 5:139426649-139426671 5:139426675-139426697
Sequence CCCCCTCAGTTCGGGTTCCCAGT CACAAGTCCCAGGCATGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89} {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!