ID: 998123461_998123462

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 998123461 998123462
Species Human (GRCh38) Human (GRCh38)
Location 5:139598918-139598940 5:139598952-139598974
Sequence CCTTTTTTTTTTTTTTTTTTTTT AAGTCTCGTTCTGTTGTCCCAGG
Strand - +
Off-target summary {0: 22235, 1: 21563, 2: 42018, 3: 80771, 4: 155626} {0: 1, 1: 0, 2: 4, 3: 112, 4: 759}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!