ID: 998133985_998133989

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 998133985 998133989
Species Human (GRCh38) Human (GRCh38)
Location 5:139665209-139665231 5:139665233-139665255
Sequence CCCTCTCTGCGCCTGTGTGTGAG TAATTAATCTCAGCCCCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 305} {0: 1, 1: 0, 2: 0, 3: 16, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!