ID: 998141264_998141269

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998141264 998141269
Species Human (GRCh38) Human (GRCh38)
Location 5:139700905-139700927 5:139700920-139700942
Sequence CCATGCGGTACCCTCCTCTTTTG CTCTTTTGGCCCCACCCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 70, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!