ID: 998167102_998167111

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 998167102 998167111
Species Human (GRCh38) Human (GRCh38)
Location 5:139850473-139850495 5:139850513-139850535
Sequence CCTCAGGAGCAGGAACCTGGCAG AGCCAGGCCTGCCCAGCACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 451} {0: 1, 1: 1, 2: 6, 3: 79, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!