ID: 998173757_998173767

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 998173757 998173767
Species Human (GRCh38) Human (GRCh38)
Location 5:139887561-139887583 5:139887595-139887617
Sequence CCAAGCATGAGTAGTGGAGAGTA CTTTGGGCTGGAACTGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 80} {0: 1, 1: 0, 2: 4, 3: 50, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!