ID: 998209712_998209718

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 998209712 998209718
Species Human (GRCh38) Human (GRCh38)
Location 5:140185721-140185743 5:140185756-140185778
Sequence CCCTGGGGCTCCTGTGTTAAAGT AGCAAGTTCTTCCTAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!