ID: 998255397_998255401

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998255397 998255401
Species Human (GRCh38) Human (GRCh38)
Location 5:140583094-140583116 5:140583109-140583131
Sequence CCGAATAGACCTATACCAGGTAA CCAGGTAAAGAGATTGAATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 147} {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!