ID: 998266734_998266736

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 998266734 998266736
Species Human (GRCh38) Human (GRCh38)
Location 5:140672618-140672640 5:140672631-140672653
Sequence CCGTCAACGCTCAGCTCACACTT GCTCACACTTCTCGGTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 244} {0: 1, 1: 2, 2: 1, 3: 8, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!