|
Left Crispr |
Right Crispr |
| Crispr ID |
998270172 |
998270175 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:140699464-140699486
|
5:140699509-140699531
|
| Sequence |
CCTGTCTCCTCAAGAGGTAGTTT |
GGAGTCTTGCTCTGTCACCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 14, 4: 101} |
{0: 11170, 1: 44232, 2: 101511, 3: 128684, 4: 136249} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|