ID: 998282533_998282534

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998282533 998282534
Species Human (GRCh38) Human (GRCh38)
Location 5:140825548-140825570 5:140825563-140825585
Sequence CCAAGTAGCTGGGATTACAGGCA TACAGGCATGTGCCCACACCTGG
Strand - +
Off-target summary {0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316} {0: 2, 1: 4, 2: 27, 3: 182, 4: 682}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!