ID: 998287485_998287495

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 998287485 998287495
Species Human (GRCh38) Human (GRCh38)
Location 5:140877177-140877199 5:140877224-140877246
Sequence CCGGCTGGCAGCGCAGGAGGCGC GGTGGGTGCGGGCCACGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 192} {0: 2, 1: 3, 2: 3, 3: 27, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!