ID: 998322762_998322779

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 998322762 998322779
Species Human (GRCh38) Human (GRCh38)
Location 5:141247584-141247606 5:141247630-141247652
Sequence CCTACCTGCCGCTCCCAGAGGCG CTCGCTTACCGTCTACCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 11, 3: 12, 4: 187} {0: 1, 1: 2, 2: 15, 3: 1, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!