ID: 998322764_998322769

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998322764 998322769
Species Human (GRCh38) Human (GRCh38)
Location 5:141247588-141247610 5:141247603-141247625
Sequence CCTGCCGCTCCCAGAGGCGGCCC GGCGGCCCCGGCCCAAGCCCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 12, 3: 39, 4: 380} {0: 2, 1: 7, 2: 10, 3: 67, 4: 658}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!