ID: 998322772_998322784

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 998322772 998322784
Species Human (GRCh38) Human (GRCh38)
Location 5:141247610-141247632 5:141247645-141247667
Sequence CCGGCCCAAGCCCAGGCCGACTC CCTGGTGGTGGCATTGGCCTCGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 7, 3: 30, 4: 294} {0: 4, 1: 11, 2: 4, 3: 37, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!