ID: 998322774_998322780

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 998322774 998322780
Species Human (GRCh38) Human (GRCh38)
Location 5:141247615-141247637 5:141247633-141247655
Sequence CCAAGCCCAGGCCGACTCGCTTA GCTTACCGTCTACCTGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 69} {0: 1, 1: 8, 2: 9, 3: 4, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!