ID: 998344651_998344656

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 998344651 998344656
Species Human (GRCh38) Human (GRCh38)
Location 5:141451113-141451135 5:141451138-141451160
Sequence CCACCACACCCAGCCTTATGATT ATTTAGACTAGACATTTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 14, 2: 179, 3: 1377, 4: 6378} {0: 1, 1: 0, 2: 3, 3: 29, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!