ID: 998374504_998374516

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 998374504 998374516
Species Human (GRCh38) Human (GRCh38)
Location 5:141682027-141682049 5:141682065-141682087
Sequence CCGGGCAGCAGGAGGGAGGGGCG GGGGAGGGCCGCCGGCGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 80, 4: 660} {0: 1, 1: 0, 2: 4, 3: 38, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!