ID: 998385142_998385157

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 998385142 998385157
Species Human (GRCh38) Human (GRCh38)
Location 5:141753251-141753273 5:141753304-141753326
Sequence CCGTGGATCCAGCTCTGGCTCCG GGGAGAGGAACGTCCCTCCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!