ID: 998420212_998420216

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 998420212 998420216
Species Human (GRCh38) Human (GRCh38)
Location 5:141978397-141978419 5:141978445-141978467
Sequence CCCTAGCATACTTGAATATTGTC CTCAGAAAAAAGTGCAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 110} {0: 1, 1: 0, 2: 4, 3: 57, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!