ID: 998493460_998493466

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 998493460 998493466
Species Human (GRCh38) Human (GRCh38)
Location 5:142566692-142566714 5:142566711-142566733
Sequence CCGCCAAGGCCCAGGAAGCCACT CACTGCTGCAGGAAGTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 444} {0: 1, 1: 0, 2: 1, 3: 20, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!