ID: 998507093_998507097

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 998507093 998507097
Species Human (GRCh38) Human (GRCh38)
Location 5:142680828-142680850 5:142680858-142680880
Sequence CCTGATCTTCTTTAATTGTGCTC CAAAGGCAACAGAATTACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 185} {0: 1, 1: 0, 2: 2, 3: 22, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!