ID: 998545720_998545728

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 998545720 998545728
Species Human (GRCh38) Human (GRCh38)
Location 5:143025785-143025807 5:143025833-143025855
Sequence CCTGGATGCCTGTCTTTTGCCAA CCCTGACTGTGGCTGAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 172} {0: 1, 1: 0, 2: 2, 3: 26, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!