ID: 998788871_998788876

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 998788871 998788876
Species Human (GRCh38) Human (GRCh38)
Location 5:145744236-145744258 5:145744274-145744296
Sequence CCTTTTCTCCTGCAGACCAGCAG AGACTTAGTTCTGAGGAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 326} {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!