ID: 998938655_998938666

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 998938655 998938666
Species Human (GRCh38) Human (GRCh38)
Location 5:147257219-147257241 5:147257239-147257261
Sequence CCAACTACAGCATAAAAGCTCTA CTACGTCGGGGGCGGGGCGGGGG
Strand - +
Off-target summary {0: 10, 1: 30, 2: 50, 3: 41, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!