ID: 999193080_999193098

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 999193080 999193098
Species Human (GRCh38) Human (GRCh38)
Location 5:149763148-149763170 5:149763200-149763222
Sequence CCCTCCCCACTCTGGCCCTGCAG TGGTCCTGCAGGTCTCATTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 91, 4: 688} {0: 1, 1: 0, 2: 2, 3: 11, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!