ID: 999223577_999223585

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 999223577 999223585
Species Human (GRCh38) Human (GRCh38)
Location 5:150001132-150001154 5:150001176-150001198
Sequence CCAAGCGCCTCCGGGAATGTGAG CCGGGTAAGTCCCGCCTTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84} {0: 1, 1: 0, 2: 0, 3: 1, 4: 13}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!