ID: 999276700_999276705

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 999276700 999276705
Species Human (GRCh38) Human (GRCh38)
Location 5:150336038-150336060 5:150336063-150336085
Sequence CCATGATTAGATGTAGACAGGCA GAATCAAGAAGGGCCCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95} {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!