ID: 999309110_999309115

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 999309110 999309115
Species Human (GRCh38) Human (GRCh38)
Location 5:150540162-150540184 5:150540192-150540214
Sequence CCTGCACTCCTGGACGAACCTCC GACACTGCCCCCTGTGCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 143} {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!