ID: 999397360_999397362

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 999397360 999397362
Species Human (GRCh38) Human (GRCh38)
Location 5:151238550-151238572 5:151238572-151238594
Sequence CCCAGCAGCTAAAAATAAAACTT TCCGCTCCCCCTCCTGCCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 45, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!