ID: 999468807_999468812

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 999468807 999468812
Species Human (GRCh38) Human (GRCh38)
Location 5:151832627-151832649 5:151832673-151832695
Sequence CCTCCAAGAAATACAGGACTCTG GTTGGTGTACCTGAAAGTGACGG
Strand - +
Off-target summary {0: 1, 1: 32, 2: 357, 3: 6544, 4: 2860} {0: 22, 1: 4124, 2: 2162, 3: 942, 4: 673}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!