ID: 999475059_999475065

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 999475059 999475065
Species Human (GRCh38) Human (GRCh38)
Location 5:151890836-151890858 5:151890869-151890891
Sequence CCTGGGGGTTATGTTAACAATGC GGCCTCAGGAACAAGGTGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 33, 4: 475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!